Sequence ID | >WENV170163127 |
Genome ID | CEOM01097269 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 187 |
End posion on genome | 262 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ggggtgggtt |
tRNA gene sequence |
GGACGTATAGTGTAGTTGGATATCACTCTGGCCTTCTAAGCCGGCGACCCGGGTTCGAAT |
Downstream region at tRNA end position |
cgaattaatt |
Secondary structure (Cloverleaf model) | >WENV170163127 Arg TCT t GCCA cgaattaatt G - C G - C A - T C - G G - C T - A A - T T A T G G T C C A T G A A | | + | | G T T G T G C C G G G C G | | | T T G T C A C A T A T CGAC C - G T + G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |