Sequence ID | >WENV170163369 |
Genome ID | CEOM01125188 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 264 |
End posion on genome | 175 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gttttttttt |
tRNA gene sequence |
GGAGAGGTGGCCGAGCGGTTGAAGGCGCACGCTTGGAAAGCGTGTATAGGGGAAACTCTA |
Downstream region at tRNA end position |
gaaattttaa |
Secondary structure (Cloverleaf model) | >WENV170163369 Ser GGA t GCCA gaaattttaa G - C G - C A - T G - C A - T G - C G + T T A T T A C C C A C G A G | | | | | G G G C C G A T G G G C G | | | T T T A G G C T G A G TATAGGGGAAACTCTATC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |