Sequence ID | >WENV170163583 |
Genome ID | CEOM01150891 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 318 |
End posion on genome | 391 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttataaaatt |
tRNA gene sequence |
GGGGCCATAGCTCAGTTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCGTCGGTTCGATT |
Downstream region at tRNA end position |
tttgcacaaa |
Secondary structure (Cloverleaf model) | >WENV170163583 Ala TGC t ACat tttgcacaaa G - C G - C G + T G - C C - G C - G A - T T T T C T G C C A T G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |