Sequence ID | >WENV170163727 |
Genome ID | CEOM01168920 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 258 |
End posion on genome | 333 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gcaaccgcta |
tRNA gene sequence |
GGGCGCGTAGCTCAGTTGGTTCAGAGCACTTGGTTTACACCCAAGGGGTCAGGGGTTCGA |
Downstream region at tRNA end position |
ttttaacctc |
Secondary structure (Cloverleaf model) | >WENV170163727 Val TAC a ACat ttttaacctc G - C G - C G - C C - G G - C C - G G - C T A T T T C C C A T T G A A | + | | | G G C T C G A G G G G C G | | | | T T T G A G C T C A A GGGTC C - G T - A T - A G - C G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |