Sequence ID | >WENV170164028 |
Genome ID | CEOM01195773 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 12 |
End posion on genome | 89 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
cataacatta |
tRNA gene sequence |
GGGCCATTAGCTCAATTGGATTAGAGCGCTCGTCTTCGGAACGAGAGGTTGAGAGTTCAA |
Downstream region at tRNA end position |
aatagaatac |
Secondary structure (Cloverleaf model) | >WENV170164028 Arg TCG a ACCA aatagaatac G - C G - C G - C C - G C - G A - T T - A T G T C T T T C A T T A A A | | + | | A G C T C G G A G A G C G | | | | T T A G A G C T T A G AGGTT C - G T - A C - G G - C T - A C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |