Sequence ID | >WENV170164086 |
Genome ID | CEOM01200125 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 605 |
End posion on genome | 531 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tcaagattat |
tRNA gene sequence |
GCGGGTGTAGCTCAGTGGTAGAGCATCACGTTGCCAACGTGAGGGTCGAGAGTTCGAATC |
Downstream region at tRNA end position |
tctatttata |
Secondary structure (Cloverleaf model) | >WENV170164086 Gly GCC t TCCA tctatttata G - C C - G G - C G - C G - C T + G G - C T A T T T C T C A G A A + | | | | G T C T C G G A G A G C G | | | | T T G G A G C T A A GGGTC T - A C - G A - T C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |