Sequence ID | >WENV170164295 |
Genome ID | CEOM01234943 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 2 |
End posion on genome | 75 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
nnnnnnnnna |
tRNA gene sequence |
CGGGATGTAGCGCAGCTTGGTAGCGCATCTGCCTTGGGAGCAGGGTGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
tatagacatt |
Secondary structure (Cloverleaf model) | >WENV170164295 Pro TGG a Attt tatagacatt C - G G - C G - C G - C A - T T - A G - C T A T T G T C C A C G A A + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A A GTGTC T + G C - G T - A G - C C - G C A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |