Sequence ID | >WENV170164380 |
Genome ID | CEOM01293977 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 500 |
End posion on genome | 429 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttaattttta |
tRNA gene sequence |
AAGTGTATAGCTCAGCGGTAGAGCACTGGACTTTTAATCCATTGGTCTTGGGTTCGATCC |
Downstream region at tRNA end position |
tgtttaggta |
Secondary structure (Cloverleaf model) | >WENV170164380 Lys TTT a Attt tgtttaggta A - T A - T G - C T - A G - C T - A A - T C T T A A C C C A G A A | | | | | G C C T C G T T G G G C G | | | | T T G G A G C T A A TGGTC C T T - A G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |