Sequence ID | >WENV170164384 |
Genome ID | CEOM01297017 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 390 |
End posion on genome | 463 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caatagtttt |
tRNA gene sequence |
GATTGAATAACATAATTTGGTTAATGTGATAGATTGCAAATCTTTAAATAAGGGTTCAAA |
Downstream region at tRNA end position |
tatttaacat |
Secondary structure (Cloverleaf model) | >WENV170164384 Cys GCA t Ttaa tatttaacat G - C A - T T - A T - A G - C A - T A - T T A T T T C C C A T T A A A | | | | | A T T A C A A A G G G C G | | | | T T G A T G T T T A G AAAT A - T T T A - T G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |