Sequence ID | >WENV170164422 |
Genome ID | CEOM01327551 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 595 |
End posion on genome | 522 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aaaatctcaa |
tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGTAGAGCGACAGCCTTCCAAGCTGTAGGTCGCCGGTTCGAAC |
Downstream region at tRNA end position |
attaatagtt |
Secondary structure (Cloverleaf model) | >WENV170164422 Gly TCC a TCag attaatagtt G - C C - G G - C G - C G - C T - A G - C C A T T G G T C A T G A A + | | + | G T C T C G G C C G G C G | | | | T T G G A G C T A G AGGTC A - T C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |