Sequence ID | >WENV170164446 |
Genome ID | CEOM01339028 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 472 |
End posion on genome | 396 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tgtctaaaat |
tRNA gene sequence |
GCGCTTGTAGCTCAACTGGATAGAGCGCTTGATTACGGATCATGAGGTTCTGGGTTCAAA |
Downstream region at tRNA end position |
aaatgaaaaa |
Secondary structure (Cloverleaf model) | >WENV170164446 Arg ACG t ACCA aaatgaaaaa G - C C - G G - C C - G T - A T - A G - C T A T G A T C C A C A A A | | + | | A T C T C G C T G G G C G | | | | T T G G A G C A T A G AGGTT C - G T T T - A G - C A - T T A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |