Sequence ID | >WENV170164490 |
Genome ID | CEOM01359007 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 112 |
End posion on genome | 31 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttgttcatta |
tRNA gene sequence |
GGGTCGGTGCCCGAGTGGTTAAAGGGGGCGGATTGTAAATCCGTTGGCTTCGCCTACGTT |
Downstream region at tRNA end position |
ttttaatata |
Secondary structure (Cloverleaf model) | >WENV170164490 Tyr GTA a Attt ttttaatata G + T G - C G - C T + G C - G G - C G - C T A T C A A C C A T G A G | | | | | A G G C C C G T T G G C G | | | T T T A G G G T A A G TGGCTTCGCCTAC G + T C - G G - C G - C A - T T A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |