Sequence ID | >WENV170168931 |
Genome ID | CEOP01139926 |
Search identical group | |
Phylum/Class | [CEOP] marine metagenome genome assembly TARA_009_DCM_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 363 |
End posion on genome | 288 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cctcctctga |
tRNA gene sequence |
GGGCCGTTAGCTCAGCTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGATGGTTCGAAT |
Downstream region at tRNA end position |
tttccctcag |
Secondary structure (Cloverleaf model) | >WENV170168931 Lys TTT a ACCA tttccctcag G - C G - C G - C C - G C - G G - C T - A T A T C T A C C A C G A A | | | | | G T C T C G G A T G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |