Sequence ID | >WENV170171284 |
Genome ID | CEOQ01048222 |
Search identical group | |
Phylum/Class | [CEOQ] marine metagenome genome assembly TARA_034_DCM_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 4379 |
End posion on genome | 4298 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agtcggccac |
tRNA gene sequence |
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG |
Downstream region at tRNA end position |
tttccttaca |
Secondary structure (Cloverleaf model) | >WENV170171284 Leu GAG c Attc tttccttaca G - C C - G G - C G - C A - T T - A G - C T G T C G C T C A T A A G | | | | | A T G G T G G C G A G C G | | | T T G A C A C T A G G TGGCTTCGGCCTT C - G A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |