Sequence ID | >WENV170181929 |
Genome ID | CEOX01054220 |
Search identical group | |
Phylum/Class | [CEOX] marine metagenome genome assembly TARA_065_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 336 |
End posion on genome | 259 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gcattttggc |
tRNA gene sequence |
GGGCTCGTAGTCTAGCTCGGTTATGACGTCGCCCTTACACGGCGAAGATCCGGTGTTCAA |
Downstream region at tRNA end position |
ccgaatattt |
Secondary structure (Cloverleaf model) | >WENV170181929 Val TAC c ACTA ccgaatattt G - C G - C G - C C - G T + G C - G G - C T A T G C C A C A T C G A A | | | | | A C T C T G C G G T G C G | | | T T G T G A C T T A G AGATC T - A C - G G - C C - G C - G C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |