Sequence ID | >WENV170184674 |
Genome ID | CEOZ01126667 |
Search identical group | |
Phylum/Class | [CEOZ] marine metagenome genome assembly TARA_064_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 165 |
End posion on genome | 239 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ttcgcgattT |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGTAGAGCACCTGCATGGCATGCAGGGGGTCAGCGGTTCGAGT |
Downstream region at tRNA end position |
tttgttttag |
Secondary structure (Cloverleaf model) | >WENV170184674 Ala GGC T ATta tttgttttag G - C G - C G + T G - C C - G C - G A - T T G T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |