Sequence ID | >WENV170186433 |
Genome ID | CEPA01048275 |
Search identical group | |
Phylum/Class | [CEPA] marine metagenome genome assembly TARA_052_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 333 |
End posion on genome | 243 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttctacgccT |
tRNA gene sequence |
GGAGGGGTGGTCGAGTGGTTTAAGGCTCTAGTCTTGAAAACTAGCGTATCTGCAAGGGTA |
Downstream region at tRNA end position |
cattaatcct |
Secondary structure (Cloverleaf model) | >WENV170186433 Ser TGA T GTCA cattaatcct G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A T G A G | | | | | G G G C T G G T G G G C G | + | T T T A G G C T T A T CGTATCTGCAAGGGTACC C - G T - A A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |