Sequence ID | >WENV170190175 |
Genome ID | CEPC01072662 |
Search identical group | |
Phylum/Class | [CEPC] marine metagenome genome assembly TARA_064_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 1 |
End posion on genome | 85 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGAGAGGTGCCAGAGTGGTAATGGAGCAGATTGCTAATCTGTCGACGGGAAACCGTCGCC |
Downstream region at tRNA end position |
aaagacccaa |
Secondary structure (Cloverleaf model) | >WENV170190175 Ser GCT n GCat aaagacccaa G - C G - C A - T G - C A - T G - C G + T T A T G C C C C A G A G | | | | | G T G A C C C G G G G C G | | | T T G A T G G T A A CGACGGGAAACCGTCGC G + T C - G A - T G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |