Sequence ID | >WENV170191378 |
Genome ID | CEPD01013251 |
Search identical group | |
Phylum/Class | [CEPD] marine metagenome genome assembly TARA_064_MES_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 4667 |
End posion on genome | 4591 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atgtcggaaa |
tRNA gene sequence |
GGCTACGTAGCTCAGTTGGTTAGAGCACATCACTCATAATGATGGGGTCCCCTGTTCAAA |
Downstream region at tRNA end position |
atcagcgtca |
Secondary structure (Cloverleaf model) | >WENV170191378 Met CAT a ACCA atcagcgtca G + T G - C C - G T - A A - T C - G G - C T A T G G G A C A T G A A | | | | | A T C T C G C C C T G C G | | | | T T G G A G C T T A A GGGTC C - G A - T T - A C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |