Sequence ID | >WENV170191797 |
Genome ID | CEPD01063808 |
Search identical group | |
Phylum/Class | [CEPD] marine metagenome genome assembly TARA_064_MES_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 4255 |
End posion on genome | 4165 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cccataagcc |
tRNA gene sequence |
GGAGGGATGGCAGAGCGGTTGAATGCACCGGTCTTGAAAACCGGCATAGGTTAATAGCCT |
Downstream region at tRNA end position |
ttattaaaaa |
Secondary structure (Cloverleaf model) | >WENV170191797 Ser TGA c GCCA ttattaaaaa G - C G - C A - T G - C G - C G - C A - T T A T G T C C C A C G A G | | | | | G G G A C G C A G G G C G | | | T T T A T G C T G A A CATAGGTTAATAGCCTATC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |