Sequence ID | >WENV170198654 |
Genome ID | CEPL01030043 |
Search identical group | |
Phylum/Class | [CEPL] marine metagenome genome assembly TARA_045_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 186 |
End posion on genome | 261 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ggtatctctt |
tRNA gene sequence |
GGGGCTGTAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGTCACCGGTTCGATC |
Downstream region at tRNA end position |
agttttaagc |
Secondary structure (Cloverleaf model) | >WENV170198654 Ala TGC t ACCA agttttaagc G - C G - C G + T G - C C - G T - A G - C C T T T G G C C A C G A A | | | | | G T C T C G A C C G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |