Sequence ID | >WENV170199305 |
Genome ID | CEPL01099457 |
Search identical group | |
Phylum/Class | [CEPL] marine metagenome genome assembly TARA_045_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 106 |
End posion on genome | 181 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aagcacgagc |
tRNA gene sequence |
GGGTGGTTAGCTCAGCTGGGAGAGCATCGCCCTTACAAGGCGAGGGTCGCAGGTTCGATC |
Downstream region at tRNA end position |
atcgcatccg |
Secondary structure (Cloverleaf model) | >WENV170199305 Val TAC c ACCA atcgcatccg G - C G - C G - C T - A G - C G - C T - A C T T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |