Sequence ID | >WENV170201367 |
Genome ID | CEPQ01015833 |
Search identical group | |
Phylum/Class | [CEPQ] marine metagenome genome assembly TARA_038_MES_0.1-0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 132 |
End posion on genome | 208 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaagttttc |
tRNA gene sequence |
GGCCCAATAGCTCAGTTGGTTAGAGCATCCGACTCATAATCGGCAGGTCCCCTGTTCAAG |
Downstream region at tRNA end position |
tataaagcct |
Secondary structure (Cloverleaf model) | >WENV170201367 Met CAT c ACCA tataaagcct G - C G - C C - G C - G C - G A - T A - T T G T G G G A C A T G A A | | | | | A T C T C G C C C T G C G | | | | T T G G A G C T T A A AGGTC T C C - G C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |