Sequence ID | >WENV170219221 |
Genome ID | CEPZ01049849 |
Search identical group | |
Phylum/Class | [CEPZ] marine metagenome genome assembly TARA_039_MES_0.1-0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 26328 |
End posion on genome | 26404 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cccttaaaat |
tRNA gene sequence |
GCCCCGGTAGCTCAGCTGGATAGAGCAACAGCCTTCTAAGCTGTGGGCCACAGGTTCGAA |
Downstream region at tRNA end position |
aaacccccag |
Secondary structure (Cloverleaf model) | >WENV170219221 Arg TCT t ACAA aaacccccag G + T C - G C - G C - G C - G G - C G - C T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A A GGGCC A - T C - G A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |