Sequence ID | >WENV170219904 |
Genome ID | CEPZ01085707 |
Search identical group | |
Phylum/Class | [CEPZ] marine metagenome genome assembly TARA_039_MES_0.1-0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 825 |
End posion on genome | 901 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tccactttgc |
tRNA gene sequence |
AGGGGCGTAGTTCCAATTGGTAGAACAGCGGTCTCCAAAACCGACGGTTGGGAGTTCGAA |
Downstream region at tRNA end position |
ctttttacac |
Secondary structure (Cloverleaf model) | >WENV170219904 Trp CCA c GCCA ctttttacac A - T G - C G - C G - C G - C C - G G - C T A T C T C T C A A A C A | + | | | G T C T T G G G G A G C T | | | | T T G G A A C G T A A CGGTT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |