Sequence ID | >WENV170235940 |
Genome ID | CEQL01136443 |
Search identical group | |
Phylum/Class | [CEQL] marine metagenome genome assembly TARA_076_SRF_0.22-0.45 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 1223 |
End posion on genome | 1136 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaattccaaT |
tRNA gene sequence |
GGGAGTGTGGCGGAATTGGTAGACGCGCCGGACTTAAAATCCGTCGAGCGATTTAGCTCG |
Downstream region at tRNA end position |
ataaatttat |
Secondary structure (Cloverleaf model) | >WENV170235940 Leu TAA T ATta ataaatttat G - C G - C G - C A - T G - C T - A G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G CGAGCGATTTAGCTCGT C T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |