Sequence ID | >WENV170237783 |
Genome ID | CEQM01082885 |
Search identical group | |
Phylum/Class | [CEQM] marine metagenome genome assembly TARA_078_DCM_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 2485 |
End posion on genome | 2411 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tatttatatA |
tRNA gene sequence |
GCTAGTGTAGCTCAGTTGGTAGAGCAGCTGATTTGTAATCAGCCGGTCGGGAGTTCAAGT |
Downstream region at tRNA end position |
aaaattagaa |
Secondary structure (Cloverleaf model) | >WENV170237783 Thr TGT A TTta aaaattagaa G - C C - G T - A A - T G - C T - A G - C T G T T T C T C A T G A A + + | | | A T C T C G G G G A G C G | | | | T T G G A G C T A A CGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |