Sequence ID | >W141403425 |
Genome ID | JDWE01000005 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Frankia sp. BMG5.23 [JDWE] |
Start position on genome | 37191 |
End posion on genome | 37115 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gcactgcccg |
tRNA gene sequence |
GGGCAGGTAGCTCAGTCGGTACGAGCGTCCGCCTGAAAAGCGGAAGGTCGGCGGTTCGAC |
Downstream region at tRNA end position |
tcgctgacgt |
Secondary structure (Cloverleaf model) | >W141403425 Phe GAA g ACCA tcgctgacgt G - C G - C G - C C - G A - T G - C G - C C C T C C G C C A T G A A | | | | | G C C T C G G G C G G C G | | | | T T G G A G C T A C G AGGTC T - A C - G C - G G - C C - G C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |