Sequence ID | >WENV170246871 |
Genome ID | CEQQ01002593 |
Search identical group | |
Phylum/Class | [CEQQ] marine metagenome genome assembly TARA_076_DCM_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 13143 |
End posion on genome | 13219 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atccttgtgc |
tRNA gene sequence |
CGCGGGGTGGAGCAGTTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
gatgaagaag |
Secondary structure (Cloverleaf model) | >WENV170246871 Met CAT c ACCA gatgaagaag C A G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | + | | | A T C G A G G T A G G C C | | | | T T G G C T C G T A G AGGTC C - G T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |