Sequence ID | >WENV170247583 |
Genome ID | CEQQ01048199 |
Search identical group | |
Phylum/Class | [CEQQ] marine metagenome genome assembly TARA_076_DCM_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 1051 |
End posion on genome | 975 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
caaccaattt |
tRNA gene sequence |
GGTCTGGTAGTTCAGTTGGTTAGAATACATGCCTGTCACGCATGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
acttatcctc |
Secondary structure (Cloverleaf model) | >WENV170247583 Asp GTC t GCAA acttatcctc G - C G - C T - A C - G T - A G - C G - C T G T T G C C C A T G A A + | | | | G T C T T G G C G G G C G | | | + T T G G A A T T T A A GGGTC C - G A - T T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |