Sequence ID | >WENV170252349 |
Genome ID | CEQU01000750 |
Search identical group | |
Phylum/Class | [CEQU] marine metagenome genome assembly TARA_076_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 4 |
End posion on genome | 77 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
nnnnnnntga |
tRNA gene sequence |
GGCCGGGTGGCAGAGTGGTCATGCAGCGGATTGCAAATCCGTGTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
tctttacttt |
Secondary structure (Cloverleaf model) | >WENV170252349 Cys GCA a TCCA tctttacttt G - C G - C C - G C - G G - C G + T G - C T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T C A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |