Sequence ID | >WENV170252901 |
Genome ID | CEQU01036512 |
Search identical group | |
Phylum/Class | [CEQU] marine metagenome genome assembly TARA_076_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 130 |
End posion on genome | 206 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cacgcacaat |
tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGTTAGAGCGCCGGCCTGTCACGCCGGAGGCCGCGAGTTCAAG |
Downstream region at tRNA end position |
ttccctcctt |
Secondary structure (Cloverleaf model) | >WENV170252901 Asp GTC t GCCA ttccctcctt G - C C - G G - C G + T G - C T - A G - C T G T T G C T C A T G A A + | | | | A T C T C G G C G A G C G | | | | T T G G A G C T T A G AGGCC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |