Sequence ID | >WENV170253467 |
Genome ID | CEQU01090277 |
Search identical group | |
Phylum/Class | [CEQU] marine metagenome genome assembly TARA_076_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 298 |
End posion on genome | 373 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccaacgttga |
tRNA gene sequence |
GGGCCCGTAGCTCAGTTGGTAGAGCAACTGACTTTTAATCAGTTGGCCACAGGTTCGAAT |
Downstream region at tRNA end position |
attcaaaacc |
Secondary structure (Cloverleaf model) | >WENV170253467 Lys TTT a ACCA attcaaaacc G - C G + T G - C C - G C - G C - G G - C T A T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C T A A TGGCC A - T C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |