Sequence ID | >WENV170254563 |
Genome ID | CEQW01007021 |
Search identical group | |
Phylum/Class | [CEQW] marine metagenome genome assembly TARA_070_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 75 |
End posion on genome | 2 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tagctagtag |
tRNA gene sequence |
GGCGGAATGGCAGAATGGCTATGCAGCGGATTGCAAATCCGTGGATCTCGGTTCGACTCC |
Downstream region at tRNA end position |
tnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170254563 Cys GCA g TCCA tnnnnnnnnn G - C G - C C - G G - C G - C A - T A - T T C T G G G C C A A A G | + | | | G T G A C G C T C G G C G | | | T T G A T G C C T A GGAT G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |