Sequence ID | >WENV170265630 |
Genome ID | CERE01000616 |
Search identical group | |
Phylum/Class | [CERE] marine metagenome genome assembly TARA_070_MES_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 351 |
End posion on genome | 427 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cgcacccaaa |
tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGATAGAGTGTCGGCCTCCGAAGCCGAAGGTCGCAGGTTCAAT |
Downstream region at tRNA end position |
aatatatcaa |
Secondary structure (Cloverleaf model) | >WENV170265630 Arg CCG a GCCA aatatatcaa G - C C - G G - C C - G C - G C - G G - C T T T C G T C C A T G A A | | | | | A T C T C G G C A G G C G | | | + T T G G A G T A T A G AGGTC T - A C - G G - C G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |