Sequence ID | >WENV170267940 |
Genome ID | CERG01034626 |
Search identical group | |
Phylum/Class | [CERG] marine metagenome genome assembly TARA_068_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 1063 |
End posion on genome | 1139 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcgacaccac |
tRNA gene sequence |
AGGGGTGTAGTTCGAATTGGTAGAACAGCGGTCTCCAAAACCGATGGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
aatttactta |
Secondary structure (Cloverleaf model) | >WENV170267940 Trp CCA c GCCA aatttactta A - T G - C G - C G - C G - C T - A G - C T G T C T C C C A A A G A | + | | | G T C T T G G G G G G C T | | | | T T G G A A C G T A A TGGTT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |