Sequence ID | >WENV170268980 |
Genome ID | CERH01017376 |
Search identical group | |
Phylum/Class | [CERH] marine metagenome genome assembly TARA_072_MES_0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 4769 |
End posion on genome | 4693 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gcggcggcgg |
tRNA gene sequence |
GCGCCCGTAGCTCAGTCGGATAGAGCACCAGATTCCTAATCTGGGGGCCACAGGTTCGAA |
Downstream region at tRNA end position |
ttgacgaaaa |
Secondary structure (Cloverleaf model) | >WENV170268980 Arg CCT g ACCA ttgacgaaaa G - C C - G G - C C - G C - G C - G G - C T A T T G T C C A T G A A | | | | | G C C T C G A C A G G C G | | | | T T G G A G C A T A A GGGCC C - G C - G A - T G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |