Sequence ID | >WENV170277722 |
Genome ID | CERQ01016698 |
Search identical group | |
Phylum/Class | [CERQ] marine metagenome genome assembly TARA_065_MES_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 5880 |
End posion on genome | 5805 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggaggacatg |
tRNA gene sequence |
GTGGCTATAGCTCAGTTGGTAGAGCACCGCGTTGTGGTCGCGGGGGTCGCGGGTTCAAGT |
Downstream region at tRNA end position |
atgcgtgaca |
Secondary structure (Cloverleaf model) | >WENV170277722 His GTG g CCCA atgcgtgaca G - C T - A G - C G - C C - G T - A A - T T G T T G C C C A T G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC C - G C - G G - C C - G G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |