Sequence ID | >WENV170288494 |
Genome ID | CERX01098795 |
Search identical group | |
Phylum/Class | [CERX] marine metagenome genome assembly TARA_068_DCM_0.22-0.45 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 168 |
End posion on genome | 254 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acaatttgat |
tRNA gene sequence |
GCCAGAGTGATGAAATTGGTAGACATGACGGATTCAAAATCCGTTGCTAGAAATAGCGTG |
Downstream region at tRNA end position |
ttctttgcag |
Secondary structure (Cloverleaf model) | >WENV170288494 Leu CAA t ACCA ttctttgcag G + T C - G C - G A - T G - C A - T G - C T G T C G G C C A T A A G | | | | | A T A G T A G C C G G C G | | | T T G A C A T T A G G TGCTAGAAATAGCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |