Sequence ID | >WENV170288906 |
Genome ID | CERX01131862 |
Search identical group | |
Phylum/Class | [CERX] marine metagenome genome assembly TARA_068_DCM_0.22-0.45 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 297 |
End posion on genome | 213 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cacttattta |
tRNA gene sequence |
GCGGATGTGGCGAAATTGGTAGACGCACTAGATTTAGGATCTAGCGCCGCGAGGCTTGGG |
Downstream region at tRNA end position |
atcaaaataa |
Secondary structure (Cloverleaf model) | >WENV170288906 Leu TAG a ACTA atcaaaataa G - C C - G G - C G - C A - T T - A G - C T G T C T C C C A T A A G | + | | | G T A G C G G G G G G C G | | | T T G A C G C T A G A CGCCGCGAGGCTT C - G T - A A - T G - C A - T T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |