Sequence ID | >WENV170289929 |
Genome ID | CERY01008720 |
Search identical group | |
Phylum/Class | [CERY] marine metagenome genome assembly TARA_065_SRF_0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 650 |
End posion on genome | 575 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gcatgtagtg |
tRNA gene sequence |
GTGGGCGTAGCTCAGTTGGTAGAGCACAGGATTGTGACTCCTGTTGTCGTGGGTTCGATC |
Downstream region at tRNA end position |
cttattcaag |
Secondary structure (Cloverleaf model) | >WENV170289929 His GTG g CCCA cttattcaag G - C T - A G - C G - C G + T C - G G - C C T T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A TTGTC C - G A - T G - C G - C A - T T C T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |