Sequence ID | >WENV170293781 |
Genome ID | CESC01009627 |
Search identical group | |
Phylum/Class | [CESC] marine metagenome genome assembly TARA_078_MES_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 104 |
End posion on genome | 180 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ctcctgcttc |
tRNA gene sequence |
AGGACCATAGCTCAGTTGGTTAGAGCGCCACGTTGACATCGTGGAGGTCGGCGGTTCAAA |
Downstream region at tRNA end position |
gatttcagac |
Secondary structure (Cloverleaf model) | >WENV170293781 Val GAC c ACCA gatttcagac A - T G - C G - C A - T C - G C - G A - T T A T C C G C C A T G A A | | | | | A T C T C G G G C G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |