Sequence ID | >WENV170293961 |
Genome ID | CESC01025026 |
Search identical group | |
Phylum/Class | [CESC] marine metagenome genome assembly TARA_078_MES_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 294 |
End posion on genome | 370 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ttgaattgtt |
tRNA gene sequence |
GCAGTTATAGTACAGTCTGGTTAGTACTCGTGCTTGCCAAGTACGTGACCCGGGTTCAAA |
Downstream region at tRNA end position |
cttattgatt |
Secondary structure (Cloverleaf model) | >WENV170293961 Gly GCC t ACCA cttattgatt G - C C - G A - T G - C T - A T - A A - T T A T G G C C C A C T G A A | | | | | A T C A T G C C G G G C G | | | | T T G G T A C T T A T TGAC C - G G - C T - A G + T C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |