Sequence ID | >WENV170294435 |
Genome ID | CESC01075568 |
Search identical group | |
Phylum/Class | [CESC] marine metagenome genome assembly TARA_078_MES_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 244 |
End posion on genome | 320 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ggccgttgat |
tRNA gene sequence |
CGGCGTGTAGCGCAGCTTGGTAGCGCACTTCGTTCGGGACGAAGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
gaattcaacg |
Secondary structure (Cloverleaf model) | >WENV170294435 Pro CGG t ACCA gaattcaacg C - G G - C G - C C - G G - C T - A G - C T A T C G T C C A C G A A | | | | | G T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |