Sequence ID | >WENV170298280 |
Genome ID | CESF01083472 |
Search identical group | |
Phylum/Class | [CESF] marine metagenome genome assembly TARA_093_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 210535 |
End posion on genome | 210622 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
agacactcaa |
tRNA gene sequence |
GGAGAATTGGCAGAGTGGTCGAATGCGGCAGTCTTGAAAACTGTTGAGGGTCACACCTCC |
Downstream region at tRNA end position |
aagccttaca |
Secondary structure (Cloverleaf model) | >WENV170298280 Ser TGA a GCAA aagccttaca G - C G - C A - T G - C A - T A - T T - A T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G | | | T T T A T G C C G A G TGAGGGTCACACCTCC G + T C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |