Sequence ID | >WENV170298953 |
Genome ID | CESG01003358 |
Search identical group | |
Phylum/Class | [CESG] marine metagenome genome assembly TARA_078_MES_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 92 |
End posion on genome | 167 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
atgacgatac |
tRNA gene sequence |
AGGCCAGTAGCTCAATTGGCAGAGCAGCGGTCTCCAAAACCGCAGGTTGGGGGTTCGATT |
Downstream region at tRNA end position |
gccttcccca |
Secondary structure (Cloverleaf model) | >WENV170298953 Trp CCA c GCCA gccttcccca A - T G - C G - C C - G C - G A - T G - C T T T C T C C C A T A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |