Sequence ID | >WENV170305264 |
Genome ID | CESI01131673 |
Search identical group | |
Phylum/Class | [CESI] marine metagenome genome assembly TARA_082_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 352 |
End posion on genome | 277 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aaataaataa |
tRNA gene sequence |
GACCTGGTAGCTCAGTTGGTAGAGCATCTCCCTTTTAAGGAGAGGGTCCTGGGTTCGAGC |
Downstream region at tRNA end position |
gaagtctcat |
Secondary structure (Cloverleaf model) | >WENV170305264 Lys TTT a ACAA gaagtctcat G - C A - T C - G C - G T - A G - C G - C C G T G A C C C A T G A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |