Sequence ID | >WENV170305343 |
Genome ID | CESI01137907 |
Search identical group | |
Phylum/Class | [CESI] marine metagenome genome assembly TARA_082_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 319 |
End posion on genome | 395 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
atgcagtgtt |
tRNA gene sequence |
CGGGGTATAGCGCAGTCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
tttttatcgg |
Secondary structure (Cloverleaf model) | >WENV170305343 Pro TGG t ACCA tttttatcgg C - G G - C G - C G - C G - C T - A A - T T A T C T C T C A T G A A | + | | | G C C G C G G G G A G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |