The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0032
Genome IDBA000002
Search identical group
Phylum/ClassThermoproteota
SpeciesAeropyrum pernix K1 [BA000002]
Start position on genome 467913
End posion on genome 467835
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
cagtctggac
tRNA gene sequence
GCGGCGGTCGTCTAGCCTGGACTAGGACGCCGGCCTGCCAAGCCGGAGGTCCCGGGTTCA
AATCCCGGCCGCCGCACCA
Downstream region at tRNA end position
cccgtcatcc
Secondary structure (Cloverleaf model)
>At0032	Gly	GCC
                   c      ACCA cccgtcatcc
                     G - C
                     C - G
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        C      | | | | |     A
  T         T C T G       C C G G G     C
  G         + | | |                 T T
  G         G G A C
    A C T A        G     AGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    G C C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGCGGTCGTCTAGCCTGGACTAGGACGCCGGCCTGCCAAGCCGGAGGTCCCGGGTTCA
AATCCCGGCCGCCGCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK