Sequence ID | >At0079 |
Genome ID | DP000238 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Cenarchaeum symbiosum [DP000238] |
Start position on genome | 271171 |
End posion on genome | 271071 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cccactttgt |
tRNA gene sequence |
GCCGGGGTCGCCTAGCCTGGTAGGGCGCGCGCCTGGAAAGCGCGTTCTCGCAAGGGATCG |
Downstream region at tRNA end position |
cactatccgg |
Secondary structure (Cloverleaf model) | >At0079 Ser GGA t GCCA cactatccgg G - C C - G C - G G - C G - C G - C G + T T A T C C C T C A C G A C | | | | | G C T C C G G G G A G C T + | | | T T G G G G C G T A G TTCTCGCAAGGGATC C - G G - C C - G G - C C - G C A T A * G G A |
tRNA gene sequence including intron sequence (Lowercase is intron sequence.) | GCCGGGGTCGCCTAGCCTGGTAGGGCGCGCGCCTGGAAatcagcgaccatacAGCGCGTT |
Intron | |
Final decision | ○ |
Comments | The tRNA gene was obtained from SPLITSdb. |
Genome/Seq. Info. | [Ensembl] |
SPLITSdb | [SPLITSdb] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |